ID: 1095975621_1095975626

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1095975621 1095975626
Species Human (GRCh38) Human (GRCh38)
Location 12:47939126-47939148 12:47939155-47939177
Sequence CCTCCAGGGCCACATCATGTTGT CTCAAGCACTGAGCACTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 160} {0: 1, 1: 0, 2: 1, 3: 16, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!