ID: 1095976374_1095976382

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1095976374 1095976382
Species Human (GRCh38) Human (GRCh38)
Location 12:47943214-47943236 12:47943264-47943286
Sequence CCACCCTCCTGAGGAGGAAAGGA TCCATGAACTCTGGCCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 271} {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!