ID: 1095982715_1095982729

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1095982715 1095982729
Species Human (GRCh38) Human (GRCh38)
Location 12:47982177-47982199 12:47982215-47982237
Sequence CCAGCCGCCTCAGCCAGGCACCC TTGCTCAGTCCCACCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 473} {0: 1, 1: 2, 2: 25, 3: 121, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!