ID: 1095982881_1095982894

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1095982881 1095982894
Species Human (GRCh38) Human (GRCh38)
Location 12:47982855-47982877 12:47982884-47982906
Sequence CCATCAGTGCCAGGAGTGCCGGG ACGGGGACCCTGGAGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171} {0: 1, 1: 0, 2: 0, 3: 40, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!