ID: 1095985588_1095985591

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1095985588 1095985591
Species Human (GRCh38) Human (GRCh38)
Location 12:47997523-47997545 12:47997548-47997570
Sequence CCAGCCAGGTAAGTGCAAGCAGC TTTAAAAGCCACATTTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 112} {0: 1, 1: 0, 2: 1, 3: 45, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!