ID: 1095988613_1095988614

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1095988613 1095988614
Species Human (GRCh38) Human (GRCh38)
Location 12:48017643-48017665 12:48017682-48017704
Sequence CCGCACTATTGTCTGGGCTGTAC AATGTTCTCTCATTCTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106} {0: 1, 1: 0, 2: 3, 3: 30, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!