ID: 1095991533_1095991534

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1095991533 1095991534
Species Human (GRCh38) Human (GRCh38)
Location 12:48037821-48037843 12:48037835-48037857
Sequence CCTACAAGTATAGGTCCCCAGGT TCCCCAGGTCATCCCCAGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!