ID: 1096000135_1096000140

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1096000135 1096000140
Species Human (GRCh38) Human (GRCh38)
Location 12:48122508-48122530 12:48122536-48122558
Sequence CCAATTGGGGTGGGAGGGATCAG AATTAGGACCTTAGTAGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 217} {0: 1, 1: 0, 2: 1, 3: 12, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!