ID: 1096044083_1096044088

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096044083 1096044088
Species Human (GRCh38) Human (GRCh38)
Location 12:48546601-48546623 12:48546638-48546660
Sequence CCAAGGACATGAAACAAGACGGA TTGTTACTGATCGTTTTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 65, 3: 92, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!