ID: 1096073759_1096073768

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1096073759 1096073768
Species Human (GRCh38) Human (GRCh38)
Location 12:48789476-48789498 12:48789494-48789516
Sequence CCCCGCCCCGCCCACCGAGGGTC GGGTCGCCTTCCTTCCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 295} {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!