ID: 1096111750_1096111758

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1096111750 1096111758
Species Human (GRCh38) Human (GRCh38)
Location 12:49033148-49033170 12:49033171-49033193
Sequence CCAGCCTGTGTCCCATAAGGCCC TGACCCTGCTGTGCCAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 195} {0: 1, 1: 0, 2: 5, 3: 43, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!