ID: 1096111763_1096111770

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1096111763 1096111770
Species Human (GRCh38) Human (GRCh38)
Location 12:49033184-49033206 12:49033216-49033238
Sequence CCAGCTGGGGGGAACTGAGCACC GTCATAAGCACCTGTCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144} {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!