ID: 1096113393_1096113398

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1096113393 1096113398
Species Human (GRCh38) Human (GRCh38)
Location 12:49041532-49041554 12:49041556-49041578
Sequence CCTGCTACAGGGGGAGACCAGGC TAGGGCAGTCAGGCTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 255} {0: 1, 1: 1, 2: 5, 3: 23, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!