ID: 1096121935_1096121939

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096121935 1096121939
Species Human (GRCh38) Human (GRCh38)
Location 12:49094075-49094097 12:49094123-49094145
Sequence CCTGGGGCTGGTGACAAGGGAAA TGAAGCTGGACTCACCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 98, 4: 522} {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!