ID: 1096127994_1096128000

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096127994 1096128000
Species Human (GRCh38) Human (GRCh38)
Location 12:49134111-49134133 12:49134152-49134174
Sequence CCTGCTGACAGTGGACGTTGATC TATAAGAATTTGCAGTTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66} {0: 1, 1: 0, 2: 2, 3: 17, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!