ID: 1096154281_1096154285

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1096154281 1096154285
Species Human (GRCh38) Human (GRCh38)
Location 12:49333143-49333165 12:49333162-49333184
Sequence CCTCGTCGCCCACGTCCAGGTGC GTGCAGAATGACGCTGTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99} {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!