ID: 1096156833_1096156840

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096156833 1096156840
Species Human (GRCh38) Human (GRCh38)
Location 12:49345737-49345759 12:49345758-49345780
Sequence CCCCCGCCGGGGAGACCCGGGTA TAGTAAAGAACAAGACAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69} {0: 1, 1: 0, 2: 4, 3: 51, 4: 588}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!