ID: 1096156834_1096156841

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096156834 1096156841
Species Human (GRCh38) Human (GRCh38)
Location 12:49345738-49345760 12:49345759-49345781
Sequence CCCCGCCGGGGAGACCCGGGTAG AGTAAAGAACAAGACAGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61} {0: 1, 1: 0, 2: 3, 3: 72, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!