ID: 1096157297_1096157313

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096157297 1096157313
Species Human (GRCh38) Human (GRCh38)
Location 12:49347753-49347775 12:49347787-49347809
Sequence CCCCCCTTCCATCGGCGGCAGCG CCATGGTGCGGTGGTGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 1, 3: 33, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!