ID: 1096159809_1096159818

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1096159809 1096159818
Species Human (GRCh38) Human (GRCh38)
Location 12:49367235-49367257 12:49367284-49367306
Sequence CCGGATTCGCGCCGGCGCGAGTA TGGCGCGCACGCGCCCGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 1} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!