|
Left Crispr |
Right Crispr |
Crispr ID |
1096167578 |
1096167585 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:49437067-49437089
|
12:49437097-49437119
|
Sequence |
CCAGACGGAGTGGCTGCCGGGCG |
TCCTCACTTTTCAGACGGTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 19, 1: 834, 2: 1319, 3: 2223, 4: 2976} |
{0: 1, 1: 45, 2: 2275, 3: 3642, 4: 3972} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|