|
Left Crispr |
Right Crispr |
| Crispr ID |
1096167578 |
1096167588 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:49437067-49437089
|
12:49437105-49437127
|
| Sequence |
CCAGACGGAGTGGCTGCCGGGCG |
TTTCAGACGGTGTGGCTGCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 19, 1: 834, 2: 1319, 3: 2223, 4: 2976} |
{0: 1, 1: 21, 2: 72, 3: 1250, 4: 4079} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|