ID: 1096167583_1096167585

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1096167583 1096167585
Species Human (GRCh38) Human (GRCh38)
Location 12:49437083-49437105 12:49437097-49437119
Sequence CCGGGCGGAGGGGCTCCTCACTT TCCTCACTTTTCAGACGGTGTGG
Strand - +
Off-target summary {0: 1291, 1: 4807, 2: 5115, 3: 7429, 4: 7139} {0: 1, 1: 45, 2: 2275, 3: 3642, 4: 3972}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!