|
Left Crispr |
Right Crispr |
Crispr ID |
1096167583 |
1096167594 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:49437083-49437105
|
12:49437132-49437154
|
Sequence |
CCGGGCGGAGGGGCTCCTCACTT |
GGGGCTCCTCACTTCTCAGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 1291, 1: 4807, 2: 5115, 3: 7429, 4: 7139} |
{0: 1678, 1: 2039, 2: 4785, 3: 5902, 4: 5145} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|