ID: 1096167586_1096167592

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1096167586 1096167592
Species Human (GRCh38) Human (GRCh38)
Location 12:49437098-49437120 12:49437113-49437135
Sequence CCTCACTTTTCAGACGGTGTGGC GGTGTGGCTGCCGGGTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 218, 3: 3738, 4: 4128} {0: 1, 1: 72, 2: 659, 3: 1071, 4: 1535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!