|
Left Crispr |
Right Crispr |
| Crispr ID |
1096167586 |
1096167594 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:49437098-49437120
|
12:49437132-49437154
|
| Sequence |
CCTCACTTTTCAGACGGTGTGGC |
GGGGCTCCTCACTTCTCAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 20, 2: 218, 3: 3738, 4: 4128} |
{0: 1678, 1: 2039, 2: 4785, 3: 5902, 4: 5145} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|