ID: 1096216118_1096216127

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1096216118 1096216127
Species Human (GRCh38) Human (GRCh38)
Location 12:49798341-49798363 12:49798365-49798387
Sequence CCCTCCTACCTCTCTCTGCCCAG ACAGTGCCCCAGAGGCAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 799} {0: 1, 1: 0, 2: 0, 3: 20, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!