ID: 1096242677_1096242680

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096242677 1096242680
Species Human (GRCh38) Human (GRCh38)
Location 12:49967674-49967696 12:49967695-49967717
Sequence CCCGTGCACACGCGCGCACACAC ACACTGACCCCACACAGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 160, 4: 894} {0: 1, 1: 0, 2: 1, 3: 15, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!