ID: 1096242677_1096242684

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1096242677 1096242684
Species Human (GRCh38) Human (GRCh38)
Location 12:49967674-49967696 12:49967703-49967725
Sequence CCCGTGCACACGCGCGCACACAC CCCACACAGTCCGGGGCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 160, 4: 894} {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!