ID: 1096243742_1096243747

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1096243742 1096243747
Species Human (GRCh38) Human (GRCh38)
Location 12:49973208-49973230 12:49973248-49973270
Sequence CCAGCATGTTGGCGTGCAGGCTT GGCGCTGTTTGCAGAGTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 3, 3: 11, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!