ID: 1096257615_1096257627

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1096257615 1096257627
Species Human (GRCh38) Human (GRCh38)
Location 12:50072829-50072851 12:50072880-50072902
Sequence CCAAAATACATCTCAGCATAGGT CTGAAATAGAGCTGGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 2, 3: 23, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!