ID: 1096258861_1096258872

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1096258861 1096258872
Species Human (GRCh38) Human (GRCh38)
Location 12:50078686-50078708 12:50078725-50078747
Sequence CCCACACCCACCTGGCTCATGTC CCGCCTGCACCCCCAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271} {0: 1, 1: 0, 2: 3, 3: 17, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!