ID: 1096335192_1096335197

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1096335192 1096335197
Species Human (GRCh38) Human (GRCh38)
Location 12:50749909-50749931 12:50749938-50749960
Sequence CCACTCCAGAAGAAGCAGCATTT CCATTTTGGAAGTAGAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 306} {0: 1, 1: 7, 2: 44, 3: 154, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!