ID: 1096335433_1096335439

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096335433 1096335439
Species Human (GRCh38) Human (GRCh38)
Location 12:50751780-50751802 12:50751814-50751836
Sequence CCAGCCTGGCCAACATGGTGAAA CTGAAAATACAAATTCAGCTGGG
Strand - +
Off-target summary {0: 87987, 1: 159650, 2: 173325, 3: 160643, 4: 141633} {0: 1, 1: 8, 2: 560, 3: 9829, 4: 23414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!