|
Left Crispr |
Right Crispr |
| Crispr ID |
1096335435 |
1096335439 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:50751789-50751811
|
12:50751814-50751836
|
| Sequence |
CCAACATGGTGAAACCCAGTCTC |
CTGAAAATACAAATTCAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1486, 1: 69100, 2: 142143, 3: 132100, 4: 79506} |
{0: 1, 1: 8, 2: 560, 3: 9829, 4: 23414} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|