ID: 1096389107_1096389116

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096389107 1096389116
Species Human (GRCh38) Human (GRCh38)
Location 12:51215691-51215713 12:51215728-51215750
Sequence CCTGCATCCCACTCTCTCTTCTG ATTTTGACATGAGGGGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 538} {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!