ID: 1096389502_1096389504

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1096389502 1096389504
Species Human (GRCh38) Human (GRCh38)
Location 12:51217803-51217825 12:51217816-51217838
Sequence CCCGGGAGCTGGTCGGGACCCGC CGGGACCCGCCGCCGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110} {0: 1, 1: 0, 2: 6, 3: 51, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!