ID: 1096403128_1096403140

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096403128 1096403140
Species Human (GRCh38) Human (GRCh38)
Location 12:51323910-51323932 12:51323941-51323963
Sequence CCCAGACCCTTCGGGGCCCCTGA CCCGCCCCTCCTGCCCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119} {0: 1, 1: 0, 2: 9, 3: 89, 4: 868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!