ID: 1096457342_1096457358

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1096457342 1096457358
Species Human (GRCh38) Human (GRCh38)
Location 12:51798618-51798640 12:51798670-51798692
Sequence CCCTGCCACTATAGTCACTTTGT GCCTGGGGAAAGAGGCTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 266, 4: 436} {0: 2, 1: 175, 2: 227, 3: 177, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!