ID: 1096460180_1096460192

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096460180 1096460192
Species Human (GRCh38) Human (GRCh38)
Location 12:51818113-51818135 12:51818151-51818173
Sequence CCTCCCCACTCCCTGCCCCTGGA CCCCCCAGCATTACCAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 8, 3: 190, 4: 1320} {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!