ID: 1096464279_1096464284

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096464279 1096464284
Species Human (GRCh38) Human (GRCh38)
Location 12:51839638-51839660 12:51839669-51839691
Sequence CCTCCAGTCACATCAGCCCATTC GCTGTTCCTGTCTCCCTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!