ID: 1096475862_1096475864

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1096475862 1096475864
Species Human (GRCh38) Human (GRCh38)
Location 12:51908271-51908293 12:51908288-51908310
Sequence CCAGATTTTTCCATGGAGGCCAG GGCCAGTGCTGTGAAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 469} {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!