ID: 1096482411_1096482415

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096482411 1096482415
Species Human (GRCh38) Human (GRCh38)
Location 12:51951565-51951587 12:51951586-51951608
Sequence CCTTCGGGGGCGCGCGCGGCGGC GCCGCGGCGCCGGCTCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 226} {0: 1, 1: 0, 2: 2, 3: 51, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!