ID: 1096482411_1096482422

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1096482411 1096482422
Species Human (GRCh38) Human (GRCh38)
Location 12:51951565-51951587 12:51951607-51951629
Sequence CCTTCGGGGGCGCGCGCGGCGGC GGAGCGCACGTGCAGGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 226} {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!