ID: 1096491159_1096491166

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096491159 1096491166
Species Human (GRCh38) Human (GRCh38)
Location 12:52013867-52013889 12:52013901-52013923
Sequence CCAACCTCAGACTGGAAACTCTA AATTCGGAAGGCAGAACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195} {0: 1, 1: 0, 2: 0, 3: 17, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!