ID: 1096494251_1096494261

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1096494251 1096494261
Species Human (GRCh38) Human (GRCh38)
Location 12:52030177-52030199 12:52030210-52030232
Sequence CCTTCCTTAGGCCCTGTCTCCCT TACAGAACTCTCTGAGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 561} {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!