ID: 1096500010_1096500018

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096500010 1096500018
Species Human (GRCh38) Human (GRCh38)
Location 12:52059016-52059038 12:52059057-52059079
Sequence CCCAGAGCACCCCCAAGCCTGGG TCCACCTTCTCACCTGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 371} {0: 1, 1: 0, 2: 6, 3: 52, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!