ID: 1096520814_1096520822

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1096520814 1096520822
Species Human (GRCh38) Human (GRCh38)
Location 12:52183576-52183598 12:52183626-52183648
Sequence CCCAGAGAGAGGAAGAGAGGCTC GCGGATAGAAACCAGGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 479} {0: 1, 1: 0, 2: 1, 3: 7, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!