ID: 1096529789_1096529794

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096529789 1096529794
Species Human (GRCh38) Human (GRCh38)
Location 12:52235310-52235332 12:52235331-52235353
Sequence CCGCCTGGAGGCGGAGCTGCGGA GAGCATGCAGGATGTGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 188} {0: 1, 1: 1, 2: 2, 3: 45, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!