ID: 1096530464_1096530474

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1096530464 1096530474
Species Human (GRCh38) Human (GRCh38)
Location 12:52239500-52239522 12:52239529-52239551
Sequence CCTTCTGGACTCAGGAATTCAGG TAAGGATTCGGGAGGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 245} {0: 1, 1: 0, 2: 2, 3: 15, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!